hek293t cells atcc cat (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC hek293t cells atcc cat
Hek293t Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 12132 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hek293t+atcc+cat/293T%2F17/10__1016_slash_j__isci__2026__116022-200-114-116
Average 99 stars, based on 12132 article reviews

hek293t cells atcc cat - by Bioz Stars, 2026-09

99/100 stars

Images

Recombinant:

Article Title: CD5L promotes phagocytic removal of amyloid β oligomers and improves cognitive function in a mouse model of Alzheimer's disease.
Article Snippet: The virus solution was stereotaxically injected into the dorsal hippocampus (Anterior-Posterior -2.0 mm; Medial-Lateral +1.5 mm; DorsalVentral +3.0 mm) using a 30 G needle and a stereotaxic injector (Muromachi Kikai Co., Ltd., Japan).The mice were sacrificed .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Hamster: CHO-S Thermo Fisher Scientific Cat#A1155701 Human: HEK293T ATCC CatCRL-3216 Experimental models: Organisms/strains Mouse: C57BL6/J Clea Japan C57BL/6JJcl RRID:IMSR_JCL:JCL:MIN-0003 Mouse: Cd5l − /− (CD5L-deficient) Maehara et al.21 N/A 5xFAD The Jackson laboratory RRID:MMRRC_ Cat#034848-JAX 5xFAD/Cd5l − /− This article N/A 5xFAD/Cd5l tg/wt This article N/A Oligonucleotides Primers for QPCR This paper N/A Recombinant DNA pCAGGS-mouse or human 2CS mutant Hiramoto et al.17 N/A pCAGGS-ΔSRCR3 Yamazaki et al.49 N/A pAAV-CMV-mCD5L vector This article N/A pCAGGS-human Trem2 This article N/A Software and algorithms HALO IndicaLabs https://indicalab.com/ WES Protein simple, biotechne https://www.bio-techne.com/brands/ proteinsimple FACSDiva BD Biosciences https://www.bdbiosciences.com/ FlowJo BD Biosciences https://www.flowjo.com/ 14 Cell Reports 45, 117468, June 23, 2026 15 weeks post-injection, and their brain tissues were analyzed by immunohistochemistry for CD5L and Aβ, as well as by qPCR to assess inflammatory markers. .. Antibodies and reagents used for histological experiments are as follows: Primary antibodies included CD5L (rab2 rabbit polyclonal for IHC of mouse and human brain specimens; # 36 for mouse CD5L-Aβ binding assay and recombinant mouse CD5L purification, #7 for human CD5L-Aβ binding assay) established in our laboratory,16 with some partly purchasable from Transgenic Inc. Other antibodies included Aβ (mouse anti-β-Amyloid 1-16 antibody, 6E10, Biolegend), glial fibrillary acidic protein (GFAP; rabbit anti-GFAP antibody, ab7260, Abcam), and CD11b microbeads (clone: M1/70.15.11.5, Miltenyi Biotec).

Article Title: β2AR as a target in methamphetamine addiction: Divergent mechanisms from TAAR1.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies monoclonal anti-FLAG M2–fluorescein isothiocyanate antibody Sigma-Aldrich cat#F1804;RRID:AB_262044 AMPA Receptor 1 (GluA1) Antibody CST cat#13185;RRID:AB_2732897 AMPA Receptor 2 (GluA2) Antibody CST cat#13607;RRID:AB_2650557 AMPA Receptor 3 (GluA3) Antibody CST cat#4676;RRID:AB_10547136 Phospho-AMPA Receptor1 (GluA1)(Ser845) Antibody CST cat#8084;RRID:AB_10860773 Phospho-AMPA Receptor 1 (GluA1)(Ser831) Antibody CST cat#75574;RRID:AB_2799873 Phospho-AMPA Receptor 2 (GluA2) (Tyr869/Tyr873/Tyr876) Antibody CST cat#3921;RRID:AB_1642146 Mouse Anti-β actin mAb ZSGB-BIO cat#TA-09;RRID:AB_2636897 Bacterial and virus strains rAAV-D1-mCherry BrainVTA cat#PT-0757 rAAV-D2-EGFP BrainVTA cat#PT-3245 DH5α TIANGEN cat#CB101-03 Bac-to-Bac Baculovirus Expression System Invitrogen cat#10359016 Chemicals, peptides, and recombinant proteins S(+)-Methamphetamine (S-METH) Sigma-Aldrich-Supelco cat#M-020 R(− )-Methamphetamine (R-METH) Sigma-Aldrich-Supelco cat#M-024 (±)-MDMA Sigma-Aldrich-Supelco cat#M-013 (±)-Amphetamine Stanford Chemicals cat#AMP-0990-10 Epinephrine Sigma-Aldrich cat#E4250 Zenidolol hydrochloride MedChemExpress cat#HY-13951 Clenbuterol hydrochloride MedChemExpress cat#HY-B1614 RO 5212773 MedChemExpress cat#HY-110098 RO5166017 MedChemExpress cat#HY-12699 Coelenterazine 400a NanoLight cat#340-500 Lauryl Maltose Neopentyl Glycol (LMNG) Anatrace cat#NG310 Cholesterol Hemisuccinate TRIS Salt (CHS) Anatrace cat#CH210 Apyrase NEB cat#M0398S Critical commercial assays HTRF cAMP Gs Dynamic Detection Kit Cisbio cat#62a.m.4PEC HTRF IP-One Gq Detection Kit Cisbio cat#62IPAPEC Deposited data METH-β2AR-G s PDB protein bank (https://www.rcsb.org/) PDB: 9U9V METH-β2AR-G s The Electron Microscopy DataBank (https://www.ebi.ac.uk/emdb/) EMDB: EMD-63971 Experimental models: Cell lines Freestyle 293-F cells Invitrogen Cat#R790-07 HEK293T ATCC CatCRL-3216 HighFive insect cells Invitrogen Cat#B85502 (Continued on next page) 12 Cell Reports 44, 116337, October 28, 2025 .. Adult, male C57BL/6 mice (age 8–9 weeks, 18–20 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were given access to freely available food and water with a reverse 12/12 h light/dark cycle.

Article Title: Optogenetic manipulation of estrogen receptor signaling to improve estrogen deficiency
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GAPDH Abcam Cat#ab181603; RRID: AB_2687666 anti-pS2 Abcam Cat#ab92377; RRID:AB_10562112 anti-Ki67 CST Cat#12202; RRID:AB_2620142 anti-P53 Proteintech Cat#10442-1-AP; RRID:AB_2206609 anti-ERα Santa Cruz Cat#sc-8002; RRID:AB_627558 Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) Abcam Cat#ab150113; RRID:AB_2576208 Goat Anti-Rabbit IgG-HRP Abmart Cat#M21002; RRID:AB_2713951 Chemicals, peptides, and recombinant proteins DMEM GIBCO Cat#C11995500BT penicillin/streptomycin solution Beyotime Cat#C0222 phenol red-free DMEM Cienry Cat#CR-12900 charcoal-depleted FBS BI Cat#04-201-1A FBS Sigma Cat#F8318 17β-Estradiol Sigma-Aldrich Cat#E8875 TRIzol Invitrogen Cat#15596018 1×SDS-PAGE sample loading buffer Beyotime Cat#P0015A cOmplete TM Roche Cat#4693132001 (Hydroxypropyl)methyl cellulose Sigma-Aldrich Cat#423173 Pluronic F127 Sigma-Aldrich Cat#P2443 Schiff’s reagent Haokebio Cat#HK2022 OCT embedding agent Servicebio Cat#G6059 Universal tissue fixative Servicebio Cat#G1101 Critical commercial assays Lipofectamine 3000 Thermo Cat# L3000015 Fast All-in-One RT Kit ES Science Cat#RT001 2×Super SYBR Green qPCR Master Mix ES Science Cat#QP002 CCK8 Beyotime Cat#C0037 Deposited data high-affinity estrogen response elements in human Bourdeau et al. 34 http://mapageweb.umontreal.ca/maders/ eredatabase/#:∼:text=We%20have %20screened%20for%20high%20affinity %20EREs%20%28perfect,∼70% 2C000%20motifs%20in%20the%20human %20and%20mouse%20genomes. .. Experimental models: Cell lines MCF-7 ATCC Cat#HTB-22 HEK293T ATCC CatCRL-3519 Experimental models: Organisms/strains C57BL/6J mice Shanghai SLAC Laboratory Animal Co,Ltd – Recombinant DNA 3X ERE TATA luc Hall et al. 53 Addgene plasmid # 11354 pLV-OptoER GENEWIZ – (Continued on next page) e1 iScience 29, 115105, March 20, 2026 ..

Article Title: HUWE1 stimulates mTORC1 activity by enhancing Rheb interaction with mTORC1 and supports de novo pyrimidine synthesis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse monoclonal anti-HA (clone 16B12) Covance Cat#MMS-101R; RRID:AB_291262 Mouse monoclonal anti-ubiquitinylated proteins (FK2) MilliporeSigma Cat#04–263; RRID:AB_612093 Alexa Fluor 594-goat polyclonal anti-rabbit IgG Thermo Fisher Scientific Cat#A11012; RRID:AB_141359 Alexa Fluor 488-goat polyclonal anti-mouse IgG Thermo Fisher Scientific Cat#A11029; RRID:AB_138404 Alexa Fluor 594-goat polyclonal anti-mouse IgG Thermo Fisher Scientific Cat#R37121; RRID:AB_2556549 Anti-rabbit IgG HRP-Linked Whole Ab GE Healthcare Cat#NA934; RRID:AB_772206 Anti-mouse IgG HRP-Linked Whole Ab GE Healthcare Cat#NA931; RRID:AB_772210 Bacterial and virus strains One Shot TM Stbl TM Chemically Competent E. coli Thermo Fisher Scientific Cat#C737303 Chemicals, peptides, and recombinant proteins Amino acid mixtures Sigma-Aldrich Cat#R7131 L-Glutathione reduced Sigma-Aldrich Cat#G4251 N-Ethylmaleimide (NEM) Sigma-Aldrich Cat#E3876 Saponin Sigma-Aldrich Cat#S4521 Actinomycin D Sigma-Aldrich Cat#A9415 Lipofectamine 3000 Invitrogen Cat#L3000001 Amino acid-free DMEM medium US Biological Life Sciences Cat#D9800-27 Leucine-free DMEM medium Crystalgen Cat#226-024 L-leucine RPI Cat#L22000 Dialyzed Fetal Bovine Serum Thermo Fisher Scientific Cat#26400044 Pierce TM Glutathione Agarose Thermo Fisher Scientific Cat#16100 Prolong Gold antifade reagent with DAPI Thermo Fisher Scientific Cat#P36931 Protein G Sepharose 4 Fast Flow GE Healthcare Cat#17061801 Flag peptide LifeTein Cat#LT12022 Insulin Sigma-Aldrich Cat#10908 Phosphorus-32 NEN Radiochemicals Cat#NEX011 MgATP Solution R&D Systems Cat#B-20 Critical commercial assays Subcellular Protein Fractionation Kit Thermo Fisher Scientific Cat#78840 TriFECTa RNAi Kits Integrated DNA Technologies (IDT) N/A Experimental models: Cell lines Human: HEK293T ATCC CatCRL-3216 Human: HeLa Yoshida et al. 71 N/A Human: HepG2 Sakasai-Sakai et al. 72 N/A Mouse: embryonic fibroblasts Yoshida et al. 71 N/A Mouse: embryonic fibroblasts p53 − /− Dr. David J Kwiatkowski 46 N/A Experimental models: Organisms/strains B6.129P2(Cg)-Huwe1 tm1.1Mak /J The Jaxon Laboratory Hao et al. 73 Strain#029254; RRID:IMSR_JAX:029254 B6.Cg-Speer6-ps1 Tg(Alb-cre)21Mgn /J The Jaxon Laboratory Postic et al. 74 Strain#003574; RRID:IMSR_JAX:003574 Oligonucleotides shRNA targeting HUWE1-1 (H and M) 5 ′ -GCATCTGTACAGTTCCATAGA This paper N/A shRNA targeting HUWE1-2 (H and M) 5 ′ -TGCCGCAATCCAGACATAT This paper N/A (Continued on next page) 18 Cell Reports 44, 116382, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER shRNA targeting HUWE1-3 (H and M) 5 ′ -GCTCAATACTAGCCGTCTACA This paper N/A shRNA targeting HUWE1-4 (H) 5 ′ -GGGAATTTCCCACCAGGATGA This paper N/A sgRNA targeting HUWE1 (H) 5 ′ -GCTGAACTTCACCTGAATCG This paper N/A sgRNA targeting GFP 5 ′ -CTTGTCACTACTTTCGGTTA Yao et al. 20 N/A shRNA targeting CAD-1 (M) 5 ′ -GCTCAGATCCTAGTGCTAACG This paper N/A shRNA targeting CAD-2 (M) 5 ′ -GGTGGTGATGGACATCTATGA This paper N/A siRNA sequences for HUWE1, see Table S1 Integrated DNA Technologies (IDT) N/A RT-qPCR primer sequences, see Table S2 This paper N/A Recombinant DNA pLKO1-Sc (Scramble shRNA) Sarbassov et al. 75 Addgene plasmid #1864 Lenti-CRISPR v2 Sanjana et al. 76 Addgene plasmid #52961 psPAX2 Dr. Didier Trono Addgene plasmid #12260 pMD2.G Dr. Didier Trono Addgene plasmid #12259 pcDNA3-HA-Ubiquitin Kamitani et al. 77 Addgene plasmid #18712 pcDNA3-Flag-HA-CAD Ben-Sahra et al. 31 Addgene plasmid #46238 pENTR1A-HUWE1 Dr. Jeanette G Cook Addgene plasmid #37431 pENTR1A-HUWE1 C4341S Dr. Jeanette G Cook Addgene plasmid #37432 pRK7-Flag-human Rheb This paper N/A pRK7-Flag-human Rheb C181S This paper N/A pRK7-Flag-human Rheb S16H This paper N/A pRK7-Flag-human Rheb G18A This paper N/A pRK7-Flag-human Rheb G18A C181S This paper N/A pRK7-Flag-human Rheb S20N This paper N/A pRK7-Flag-human Rheb S20A This paper N/A pRK7-Flag-human Rheb D60K This paper N/A pRK7-Flag-human Rheb D60I This paper N/A pRK7-Flag-human Rheb Q64L This paper N/A pRK5-HA-GST-human Rheb This paper N/A pcDNA3-Flag-CAD This paper N/A pcDNA3-HA-CAD This paper N/A pcDNA3-HA-CAD GLN This paper N/A pcDNA3-HA-CAD CPSase A This paper N/A pcDNA3-HA-CAD CPSase B This paper N/A pcDNA3-HA-CAD GLN CPSase This paper N/A pRK7-Flag-HUWE1 This paper N/A pRK7-Flag-HUWE1 C4341S This paper N/A pRK7-Flag-HUWE1 UBA-NLS This paper N/A pRK7-Flag-HUWE1 HECT This paper N/A pRK7-Flag-HUWE1 HECT C4341S This paper N/A pGEX-KG-GST-Rheb Inoki et al. 10 N/A AAV-TBG-GFP This paper N/A AAV-TBG-Cre This paper N/A (Continued on next page) Cell Reports 44, 116382, October 28, 2025 19

Article Title: Controlled pyroptosis of engineered macrophages enables biphasic antitumor via the release of oncolytic bacteria and inflammatory signals.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC-conjuagted-anti-MHCII BD Biosciences Cat#562009; RRID:AB_10893593 FITC-conjuagted-anti-CD3 BD Biosciences Cat#561801; RRID:AB_10895388 FITC-conjuagted-anti-CD11b BD Biosciences Cat#561684; RRID:AB_10893796 FITC-conjuagted-anti-CD44 BD Biosciences Cat#553133; RRID:AB_2076224 PE-Cy7-conjuagted-anti-CD11c BD Biosciences Cat#558079; RRID:AB_647251 PE-Cy7-conjuagted-anti-CD8 BD Biosciences Cat#552877; RRID:AB_394506 PE-conjuagted-anti-CD8 BD Biosciences Cat#554857; RRID:AB_395558 PE-conjuagted-anti-Foxp3 BD Biosciences Cat#563101; RRID:AB_2738006 PerCP-Cy5.5-conjuagted-anti-CD4 BD Biosciences Cat#550954; RRID:AB_393977 BV421-conjuagted-anti-F4/80 BD Biosciences Cat#565411; RRID:AB_2734779 BV510-conjuagted-anti-CD45 BD Biosciences Cat#740131; RRID:AB_2739888 APC-conjuagted-anti-CD62L BD Biosciences Cat#553152; RRID:AB_398533 APC-conjuagted-anti-F4/80 BD Biosciences Cat#566787; RRID:AB_2869866 APC-conjuagted-anti-CD11b BD Biosciences Cat#553312; RRID:AB_398535 APC-conjuagted-anti-CD206 Thermo Fisher Scientific Cat#17-2061-82; RRID:AB_2637420 APC-conjuagted-anti-GzmB Thermo Fisher Scientific Cat#17-8898-82; RRID:AB_2688068 PE-conjuagted-anti-CD86 Thermo Fisher Scientific Cat#12-0862-82; RRID:AB_465768 OVA257-264 (SIINFEKL) peptide bound to H-2Kb Monoclonal Antibody-APC Thermo Fisher Scientific Cat#17-5743-80; RRID:AB_1311288 FITC-conjuagted-anti-CD45.1 Biolegend Cat#110705; RRID:AB_313494 Anti-GSDMD rabbit mAb Abcam Cat#ab209845; RRID:AB_2783550 Anti-tubulin rabbit mAb ABclonal Cat#A12289; RRID:AB_2861647 HRP-conjugated Goat anti-Rabbit IgG ABclonal Cat#AS014; RRID:AB_2769854 Bacterial and virus strains Salmonella Typhimurium VNP20009 (VNP) ATCC Cat#202165 VNP-2 (VNP strains constitutively expresses RFP) This paper N/A DLV (VNP strains defective in lon gene) This paper N/A DLV-1(DLV strains constitutively expresses sfGFP) This paper N/A DLV-2 (DLV strains constitutively expresses RFP) This paper N/A DLV-3(DLV strains constitutively expresses luxCDABE) This paper N/A DLV-4(DLV strains constitutively expresses Nirfp) This paper N/A DLV-5(DLV strains expresses RFP with the aid of the sifB promoter) This paper N/A DLV-6(DLV strains expresses lysE with the aid of the sifB promoter) This paper N/A Chemicals, peptides, and recombinant proteins Mycoplasma removal reagent Yeasen Cat#40607ES03 transfection reagents Yeasen Cat#40802ES08 fixable viability dye BD Cat#564407 Hoechst dye KeyGEN BioTECH Cat#KGA1804-10 (Continued on next page) 18 Cell Reports 45, 116918, February 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Near-infrared lipophilic carbocyanine tracer DiR KeyGEN BioTECH Cat#KGE2603-5 Rhodamine MACKLIN Cat#R817228 ICG MACKLIN Cat#I953656 Luciferase substrate Vazyme Cat#DD1210 H2DCFDA MedChemExpress Cat#HY-D0940 Triton X-100 Sigma-Aldrich Cat#93443 M-CSF Yeasen Cat#91109ES10 GM-CSF Diane Biologics Cat#PDEM100050 IL4 protein Bioworld Cat#BK0246 DMF MedChemExpress Cat#HY-17363 DSF MedChemExpress Cat#HY-B0240 TAK-242 Selleck Cat#S7455 TH1020 MedChemExpress Cat#HY-116961 anti-PD1 antibody MedChemExpress Cat#A2122 Critical commercial assays Uniclone One-Step Seamless Cloning Kit Genesand Cat#SC612 T4 DNA ligase Sangon Biotech Cat#B600511-0001 FreeZol Reagent Vazyme Cat#R711-01 Reverse transcription kit Thermo Scientific Cat#M16315 AceQ qPCR SYBR Green Master Mix Vazyme Cat#Q221-01 permeabilization and fixation kit BD Biosciences Cat#555028 LDH Cytotoxicity Assay Kit Solarbio Cat#BC0680 ABplex Mouse Cytokine 15-Plex Assay Kit Abclonal Cat#RK05203 HMGB1 ELISA kit BYabscience Cat#BYHS504658 Deposited data Data files for RNA-sequencing This paper GEO: GSE291580 Experimental models: Cell lines 4T1 ATCC Cat#CRL-2539 H22 BLUEFBIO Cat#BFN608007276 A20 ATCC Cat#TIB-208 Panc02 Servicebio CatSTCC20054 HEK293T ATCC Cat#CRL-11268 L929 ATCC Cat#CCL-1 4T1-GFP This paper N/A 4T1-OVA This paper N/A Experimental models: Organisms/strains Mouse: BALB/c Cavens N/A Mouse: C57BL/6J Cavens N/A Mouse: C57BL/6Smoc-Gsdmdem1Smoc Shanghai Model Organisms Center Inc N/A Oligonucleotides Primers for qPCR, see Table S1 This paper N/A Recombinant DNA pHR-pHSP-eGFP-PGK-mCherry Addgene Cat#191862 pHR-pHSP-Luciferase This paper N/A pHR-pHSP-GSDMD-N This paper N/A pTh23 pJ23100-RFP This paper N/A pTh23 pJ23100-sfGFP This paper N/A (Continued on next page) Cell Reports 45, 116918, February 24, 2026 19 ..

Mutagenesis:

Software:

Immunohistochemistry:

Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

Real-time Polymerase Chain Reaction:

other:

Article Title: Vorapaxar enhanced mitochondria-associated ferroptosis primes cancer immunotherapy via targeting FOXO1/HMOX1 axis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER RIPA lysis buffer Beyotime Cat#P0013C BCA reagent Beyotime Cat#P0011 Clarity Western ECL Substrates BIO-RAD Cat#1705061 Goat serum blocking solution ZSGB-Bio Cat#ZLI-9056 Critical commercial assays Lipid Peroxidation Assay Kit Merck Cat#MAK085 GSH and GSSG assay kit Beyotime Cat#S0053 Glutathione Peroxidase Assay Abcam Cat#ab102530 Human Coenzyme Q10 ELISA Kit Cusabio Cat#CSB-E14081h ATP assay kit Beyotime Cat#S0026 Mitochondria Isolation Kit for Cultured Cells MedChemExpress Cat#HY-K1060 Universal Two-Step Polymer Detection System ZSGB-Bio Cat#PV-9000 DAB Substrate Kit ZSGB-Bio Cat#ZLI-9018 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat#00-5523-00 EZ-LinkTM NHS-LC-LC-Biotin kit Thermo Fisher Scientific Cat#21343 Pierce Zeba Thermo Fisher Scientific Cat#89882 HiScript Q RT SuperMix kit Vazyme Cat#R223-01 Zombie AquaTM Fixable Viability Kit BioLegend Cat#423102 Deposited data RNA-seq data This paper https://zenodo.org/records/16757395 RNA-seq data of inhouse cohort He et al.32 https://doi.org/10.1038/s41392-022-01067-y RNA-seq data of Ribas’s cohort Campbel et al.33 https://github.com/ParkerICI/MORRISON-1-public Experimental models: Cell lines Mouse: B16F10 ATCC Cat#CRL-6475 Human: A375 ATCC Cat#CRL-1619 Human: SK-MEL-28 ATCC Cat#HTB-72 Human: HEK293T ATCC Cat#CRL-3216 Human: MHCC97-H CAS Cell Bank Cat#SCSP-5092 Human: HCC-LM3 Procell Cat#CL-0278 Human: NCI-H1975 Procell Cat#CL-0298 Human: SW480 Procell Cat#CL-0223 Experimental models: Organisms/strains BALB/c nude mice GemPharmatech N/A C57BL/6 mice Hunan SLAC N/A NCG mice GemPharmatech N/A Tyr::CreER+/+; Braf wt/wt; Ptenlox/lox mice The Jackson Laboratory Strain#013590 Tyr::CreER− /− ; Braf CA/CA; Ptenlox/lox mice The Jackson Laboratory Strain#013590 Oligonucleotides Human FOXO1 shRNA#1 CAGGACAATAAGTCGAGTTAT OBiO Technology N/A Human FOXO1 shRNA#3 GCTTAGACTGTGACATGGAAT OBiO Technology N/A Human F2R shRNA#1 GACGGCAAGGTTTAAGTTATT OBiO Technology N/A sgHMOX1 #H1 CTATGTGAAGCGGCTCCACG Shanghai sangon biotech N/A sgHMOX1 #H2 GGAGGAGATTGAGCGCAACA Shanghai sangon biotech N/A sgGPX4 GGTGAAGCGCTACGGACCCA Shanghai sangon biotech N/A (Continued on next page) Cell Reports Medicine 6, 102371, October 21, 2025 e3

Article Title: KIDINS220 and InsP8 safeguard the stepwise regulation of phosphate exporter XPR1.
Article Snippet: Article KIDINS220 and InsP8 safeguard the stepwise regulation of phosphate exporter XPR1

Review

hek293t cells atcc cat (ATCC)

Structured Review

Images

Related Articles

Recombinant:

Mutagenesis:

Software:

Immunohistochemistry:

Real-time Polymerase Chain Reaction:

other:

Staining:

Enzyme-linked Immunosorbent Assay:

Polyacrylamide Gel Electrophoresis:

Multiplex Assay:

RNA Sequencing:

Virus:

Electron Microscopy:

Plasmid Preparation:

Fractionation:

shRNA:

Luciferase:

Cloning:

Reverse Transcription:

SYBR Green Assay:

LDH Cytotoxicity Assay:

RNA sequencing:

Similar Products

Image Search Results